【摘要】 AIM: To investigate the effect of β1integrin overexpression on the apoptosis of rabbit corneal epithelial cells and the related mechanism.
METHODS: The plasmid expressing β1integrinGFP fusion protein was constructed by polymerase chain reaction (PCR), and this plasmid (β1 group) or the empty vector (mock group) was transfected into rabbit corneal epithelial cells, respectively. The expression of β1integrinGFP fusion gene was confirmed by reverse transcriptionpolymerase chain reaction (RTPCR) and Western blot. The adhesion of transfected cells to extracellular matrix (ECM) proteins was determined by adhesion assay. The apoptosis of rabbit corneal epithelial cells was assayed by Hoechst 33342 staining and DNA ladder. The phosphorylation of mitogenactivated protein (MAP) kinase was examined by Western blot.
RESULTS: Rabbit corneal epithelial cells overexpressing β1integrinGFP fusion gene were successfully established. Compared with mock group, β1integrin transfection significantly promoted the adhesive of rabbit corneal epithelial cells to ECM proteins such as laminin, fibronectin, collagen I and collagen IV. β1integrin overexpression inhibited apoptosis and induced MAP kinase phosphorylation in rabbit corneal epithelial cells (P<0.05).
CONCLUSION: These data suggest that overexpression of β1integrin confers resistance to apoptosis in rabbit corneal epithelial cells, and MAP kinase pathway may play an important role in this process.
KEYWORDS: corneal epithelial cells; β1integrin; apoptosis; MAP kinase
【关键词】 corneal epithelial cells β1integrin apoptosis MAP kinase
INTRODUCTION
Corneal transplantation utilizing cultured corneal epithelial cell in vitro overcomes the unavailability of donor corneas and postoperative transplantation rejection of penetrating keratoplasty, which shows its broad prospects. However, how to overcome cellular apoptosis in vitro, and obtain corneal epithelial cell with longterm survival and proliferation has been the bottleneck of corneal cell transplantation and the topic of great interest to researchers. β1integrin family is one of the factors that most correlated to the survival of epithelial cells [1]. In the present article we investigated the possibility and mechanism of inhibition of corneal epithelial cell apoptosis by the overexpression of β1integrin, and provided theoretical basis for the prevention of corneal epithelial cell apoptosis and clinical application of corneal cell transplantation.
MATERIALS AND METHODS
Reagents and Materials HamsF12 and DMEM (Gibco, Langley, OK, USA) mixed at 1∶1,with 100mL/L fetal bovine serum (FBS) (Gibco), 100U/mL penicillin, 100mg/L streptomycin and 0.02g/L glutamine then added and pH value adjusted to be 7.27.4, served as cell culture solution. Phosphorylated specific antiERK, p38 MAPK, JNK antibody, and total antiERK, p38 MAPK, JNK antibody (Cell Signaling, Danvers, MA, USA).
Methods
Rabbit corneal epithelial cell culture Eyeballs of adult Holland rabbits weighing 2.53.0kg were extracted aseptically and washed with normal saline after they were executed with air embolism. Corneal tissue which contains only epithelium and stroma was separated on the superclean blenches, and then was digested in 3mL 2.5g/L trypsin at 4 ℃ overnight. On the next day corneal epithelium was scraped gently with scraper and washed in Hanks solutions for three times. 2mL 100mL/L FBS contained culture solution were then added and when cells dispersed evenly, they were transferred to 24 and 6well culture plate and incubated in 50mL/L CO2 incubator at 37℃. Cell concentration is adjusted to 4×105/mL with culture solution.
Construction of the plasmid expressing β1integrinGFP fusion protein Plasmid pBJ1, provided by Dr. Y. Takada (Scripps Research Institute, USA), contains fulllength encoding sequence of β1integrin cDNA. Fulllength cDNA sequence of β1integrin lacking termination codon was obtained by polymerase chain reaction (PCR), then inserted with restriction BamH1 and XhoI restriction enzyme cutting sites at ends, and then was assembled into plasmid pT7Blue vector (Novagen, Madison, WI, USA) to form pT7GFβ1. Sequence of cDNA of β1integrin were determined by DNA sequencer. pT7GFβ1 was digested by BamH1 and XhoI
restriction enzyme, and 2.4kb fragment was recycled, and connected to the same restriction enzyme cutting site in pEGFPN1 vector (Clonetech, Palo Alto, CA, USA) to form β1integringreen fluorescein protein (GFP) fusion plasmid pEGFPN1/GFβ1, and was confirmed by restriction enzyme.
Gene transfection Cell concentration of the passage 24 cells were adjusted to 4×105/mL and these cell were transferred to the culture plate until 80% of cells fused. pEGFPN1/GFβ expressing plasmid (β1 group) and pEGFPN1 empty vector (mock groupwere transfected into cells using Lipofectamine gene transfection technology (GIBCOBRL, Grand Island, NY, USA) (refering to company specifications). Transfection solution was aspirated after 12 hours of incubation in 50mL/L CO2 incubator at 37℃ and was added into serum contained culture solution for 2 days incubation.
Reverse transcriptionpolymerase chain reaction (RTPCR) detection of mRNA expression of transfected gene in transfected cells Total RNA is extracted by total RNA extraction kit (Nippon Gene, Toyama, Japan) following its instructions. RNA quality is detected by electrophoresis and optic density is detected at 260nm wavelength. All the primers are known as the gene specific by consulting Genbank. GFP primer sequence: 5GCAAGCTGACCCTGA AGTTCATC3, reverse sequence: 5’GGATCTTGAAAT TCACCTTGATGC3’, length of PCR product is 384bp. Primer sequence of β1integrin: 5’AGAATCCAGAGTGT CCCACTGG3’, reverse sequence: 5’TTCCCTCATAC TTCGGAT TGA3’, length of PCR product is 238bp. Glyceraldehyde 3phosphate dehydrogenase (GAPDH) primer sequence: 5’ACGCATTTGGTCGTATTGGG3’, reverse sequence: 5’TGATTTTGGAGGGATCTCGC3’, length of PCR product is 231bp. β1integrinGFP fusion gene expression is detected using sense β1integrin and antisense GFP as primers. Product length is 785bp. RTPCR is conducted by the instructions of firststrand synthesis kit (Takara, Shiga, Japan). The amplifying conditions: degeneration at 95 ℃ for 1 minute, annealing at 55℃ for 1 minute, extension at 72 ℃ for 1 minute, 30 cycles. PCR products are detected by 20g/L agarose gel electrophoresis, and observed at longwavelength light after Ethidium bromide staining.
Cell adhesion test Laminin, fibronectin, type I and IV collagen coated 24well culture plate (BD Company, Franklin Lakes, NJ, US). In the control group, culture plate was coated with 10g/L BSA. At 1 hour after 1g/L BSA blocking all the wells at 37℃. Cells transfected by β1integrinGFP fusion gene expression plasmid or empty vector were added to 24well plate coated with different extracellular matrix proteins with concentration of 5×104 cells in each well. These cells were incubated in 50mL/L CO2 incubator at 37℃ for 1 hour and rinsed in PBS three times and suspension cells were removed. Number of adhesion cells was evaluated by the absorbance measured by WST1 proliferation kit.
[1] [2] [3] 下一页 |
